Propagation of MntR regulog to Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701

Reference regulog properties
Source regulog:	MntR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701
Orthologous TF(s)	SeI_A1361
Regulated genes	2

Built upon 35 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701*
	Locus tag	Position	Score	Sequence
Position: -57 Score: 6.7 Sequence: TAACATAGCAAAGGCTATATTC Locus tag: Sententer_010100022144
	Sententer_010100022144	-57	6.7	TAACATAGCAAAGGCTATATTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: sitA
Ortholog function: Iron and manganese ABC transporter, substrate-binding protein
Salmonella typhimurium LT2	STM2861	-57	6.7	TAACATAGCAAAGGCTATATTC
Citrobacter koseri ATCC BAA-895	CKO_04090	-42	6.7	TAACATAGCAAAGGCTATATTC
Citrobacter koseri ATCC BAA-895	CKO_00940	-88	6.1	AAATATAGCCTGTGCTATGTTG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03078	-76	4.7	ATAAATAGCTTGTGCTATATAA
		-57	5.7	TAACATAGCAATGGCTATAAAC
Enterobacter sp. 638	Ent638_1111	-75	6.2	AAATATAGCCTATGCTATATAA
		-56	5.3	TAAGATAGCACAGGCTAATTTT
Erwinia amylovora ATCC 49946	EAM_2087	-73	5.6	GGATATAGCCTGTGCTATATGT
		-54	4.9	TGTTATAGCAATTGCTATTTAG

Position: -128 Score: 6.8 Sequence: AGATATAGCACAGGCTATGTTT Locus tag: SeI_A1361
	SeI_A1361	-128	6.8	AGATATAGCACAGGCTATGTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Manganese homeostasis transcriptional regulator MntR, DtxR family
Salmonella typhimurium LT2	STM0835	-128	6.8	AGATATAGCACAGGCTATGTTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --