Propagation of CzrA regulog to Bacillus thuringiensis serovar konkukian str. 97-27
| Source regulog: | CzrA - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance |
| Effector: | Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus thuringiensis serovar konkukian str. 97-27 |
| Orthologous TF(s) | BT9727_0505 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -45
Score: 6.1 Sequence: TATATGAATAGTTGTTCATATG
Locus tag: BT9727_0505
|
||||
| BT9727_0505 | -45 | 6.1 | TATATGAATAGTTGTTCATATG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: czrA | ||||
| Ortholog function: Transcriptional repressor of multiple metal-sensing, ArsR family | ||||
| Bacillus cereus ATCC 14579 | BC0595 | -46 | 5.7 | TATATGAatgatTGtTCATATg |