Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Escherichia coli APEC O1

Reference regulog properties
Source regulog: Zur - Enterobacteriales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli APEC O1
Orthologous TF(s) APECO1_2424
Regulated genes 3
Built upon 65 sites [see more]
Predicted regulatory interactions in Escherichia coli APEC O1
Locus tag Position Score Sequence
Position: -53
Score: 6.3
Sequence: GGATTGTTATATTATAACAGTTC
Locus tag: APECO1_291
APECO1_291 -53 6.3 GGATTGTTATATTATAACAGTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: pliG
Ortholog function: periplasmic lysozme inhibitor of g-type lysozyme
Escherichia coli str. K-12 substr. MG1655 b1178 -53 6.3 GGATTGTTATATTATAACAGTTC
Salmonella typhimurium LT2 STM2610 -54 5.9 TTATTGTTACAATATAACAATTA
Position: 2
Score: 6.3
Sequence: GAAATGTTATAATATCACAGTTC
Locus tag: APECO1_907
APECO1_907 2 6.3 GAAATGTTATAATATCACAGTTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: high-affinity zinc ABC transporter, substrate-binding protein
Escherichia coli str. K-12 substr. MG1655 b1857 -52 6.5 GAAATGTTATAATATCACACTTC
Salmonella typhimurium LT2 STM1891 -52 6.6 AGAATGTTATAATATCACATTTC
Citrobacter koseri ATCC BAA-895 CKO_01106 -37 6.6 AGAATGTTATAATATCACATTTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_02372 -100 6.3 TGAATGTTATAATATCACATCAC
Enterobacter sp. 638 Ent638_2426 -52 6.1 CGAATGTTATAATATCACATCCA
Erwinia amylovora ATCC 49946 EAM_2000 -52 5.9 CAAATGTTATAATATCACAAAAT
Yersinia pestis KIM y2249 -51 5.6 TGAATGTTATAATATTACGCTTT
Serratia proteamaculans 568 Spro_2773 -51 5.7 CGAATGTTATAATATCACGCCTC
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2484 -53 6.3 GTAATGTTATAATATAACAAACA
Edwardsiella tarda EIB202 ETAE_1443 -50 6.6 GGAATGTTATAATATAACGTTTC
Proteus mirabilis HI4320 PMI1152 -50 6.7 GAAACGTTATAATATAACATTTC
Photorhabdus luminescens subsp. laumondii TTO1 plu2115 -51 6.6 GAGATGTTATAATATAACAATTC