Propagation of BetI regulog to Xenorhabdus bovienii SS-2004
Source regulog: | BetI - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Glycine betaine synthesis |
Effector: | Choline |
Phylum: | Proteobacteria/gamma |
Propagated regulon: | |
Target genome | Xenorhabdus bovienii SS-2004 |
Orthologous TF(s) | XBJ1_3306 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -161
Score: 6.6 Sequence: TTAATTGAATGTTCAATCAA
Locus tag: XBJ1_3305
|
||||
XBJ1_3305 | -161 | 6.6 | TTAATTGAATGTTCAATCAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: betT | ||||
Ortholog function: choline transporter of high affinity | ||||
Escherichia coli str. K-12 substr. MG1655 | b0314 | -82 | 6.7 | TTGATTGGACGTTCAATATA |
Citrobacter koseri ATCC BAA-895 | CKO_02581 | -236 | 6.7 | TTGATTGGACGTTCAATATA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00587 | -82 | 6.7 | TTGATTGGACGTTCAATATA |
Erwinia amylovora ATCC 49946 | EAM_P133 | -243 | 5.9 | TTAATTGAATGCGCAATCAA |
Serratia proteamaculans 568 | Spro_1512 | -308 | 7 | TTGATTGAACGTTCAATAAA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1743 | -274 | 7 | TTGATTGAACGTTCAATAAA |
Proteus mirabilis HI4320 | PMI1462 | -161 | 6.5 | TTAATTGAACATTCAATCAA |
Position: -68
Score: 6.4 Sequence: TTGATTGAACATTCAATTAA
Locus tag: XBJ1_3306
|
||||
XBJ1_3306 | -68 | 6.4 | TTGATTGAACATTCAATTAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: betI | ||||
Ortholog function: transcriptional regulator of glycine betaine synthesis | ||||
Escherichia coli str. K-12 substr. MG1655 | b0313 | -66 | 6.6 | TATATTGAACGTCCAATCAA |
Citrobacter koseri ATCC BAA-895 | CKO_02582 | -48 | 6.6 | TATATTGAACGTCCAATCAA |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_00586 | -48 | 6.6 | TATATTGAACGTCCAATCAA |
Erwinia amylovora ATCC 49946 | EAM_1685 | -66 | 6.9 | TTGATTGAACGTTCAATATA |
Serratia proteamaculans 568 | Spro_1513 | -124 | 7 | TTTATTGAACGTTCAATCAA |
Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1744 | -103 | 7 | TTTATTGAACGTTCAATCAA |
Proteus mirabilis HI4320 | PMI1461 | -68 | 6.5 | TTGATTGAATGTTCAATTAA |