Propagation of MntR regulog to Enterobacter sakazakii ATCC BAA-894
| Source regulog: | MntR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Enterobacter sakazakii ATCC BAA-894 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -34
Score: 7.1 Sequence: AAACATAGCAAAGGCTATATTT
Locus tag: ESA_00848
|
||||
| ESA_00848 | -34 | 7.1 | AAACATAGCAAAGGCTATATTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntH | ||||
| Ortholog function: Manganese transporter, NRAMP family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b2392 | -34 | 6.9 | AAACATAGCAAAGGCTATGTTT |
| Salmonella typhimurium LT2 | STM2408 | -34 | 6.9 | AAACATAGCAAAGGCTATGTTT |
| Citrobacter koseri ATCC BAA-895 | CKO_00404 | -16 | 6.9 | AAACATAGCAAAGGCTATGTTT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_02743 | -35 | 7.1 | AAACATAGCAAAGGCTATATTT |
| Enterobacter sp. 638 | Ent638_2926 | -34 | 6.8 | AAACATAGCAAAGGCTATATCT |
| Erwinia amylovora ATCC 49946 | EAM_2378 | -133 | 6.4 | AAGTATAGCAATTGCTATATTT |
| Serratia proteamaculans 568 | Spro_1916 | -70 | 5.5 | AAGTGTAGCCGATGCTACATTG |