Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of UlaR regulog to Citrobacter koseri ATCC BAA-895

Reference regulog properties
Source regulog: UlaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria
Propagated regulon:
Target genome Citrobacter koseri ATCC BAA-895
Orthologous TF(s) CKO_03646
Regulated genes 1
Built upon 13 sites [see more]
Predicted regulatory interactions in Citrobacter koseri ATCC BAA-895
Locus tag Position Score Sequence
Position: -82
Score: 5.3
Sequence: TGATTACTTTTGAAAATTAG
Locus tag: CKO_03643
CKO_03643 -82 5.3 TGATTACTTTTGAAAATTAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaA
Ortholog function: Ascorbate-specific PTS system, EIIC component
Citrobacter koseri ATCC BAA-895 CKO_03643 -82 5.3 TGATTACTTTTGAAAATTAG
Escherichia coli str. K-12 substr. MG1655 b4193 -82 5.3 TGATTACTTTTGAAAATTAG
Salmonella typhimurium LT2 STM4383.S -80 5.4 TGATTACTTTTGAAAATTAA