Propagation of CueR regulog to Erwinia carotovora subsp. atroseptica SCRI1043

Reference regulog properties
Source regulog:	CueR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Erwinia carotovora subsp. atroseptica SCRI1043
Orthologous TF(s)	ECA1194
Regulated genes	2

Built upon 30 sites [see more]

Predicted regulatory interactions in *Erwinia carotovora subsp. atroseptica SCRI1043*
	Locus tag	Position	Score	Sequence
Position: -103 Score: 5.8 Sequence: ACCCTCCCCTTGCTAGAAGGT Locus tag: ECA1193
	ECA1193	-103	5.8	ACCCTCCCCTTGCTAGAAGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copA
Ortholog function: Copper-translocating P-type ATPase (EC 3.6.3.4)
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1193	-103	5.8	ACCCTCCCCTTGCTAGAAGGT

Position: -33 Score: 5.6 Sequence: ACCTTCTAGCAAGGGGAGGGT Locus tag: ECA1194
	ECA1194	-33	5.6	ACCTTCTAGCAAGGGGAGGGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cueR
Ortholog function: Copper-responsive transcriptional regulator, MerR family
Salmonella typhimurium LT2	STM0499	-33	5.4	ACCTTCCAGCAAGGTTAAGGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00465	-33	6.2	ACCTTCCAGCAAGGGGAAGGT
Enterobacter sp. 638	Ent638_0963	-33	5.4	ACCTTCCAGCAAGGTTAAGGT
Erwinia amylovora ATCC 49946	EAM_1045	-33	5.4	ACCTTCCATCAAGGGGAACGT
Yersinia pestis KIM	y1094	-33	5.6	ACCTTCCAGCAAGGTGAAGGT
Serratia proteamaculans 568	Spro_1151	-33	6.2	ACCTTCCAGCAAGGGGAAGGT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1194	-33	5.6	ACCTTCTAGCAAGGGGAGGGT
Edwardsiella tarda EIB202	ETAE_1040	-33	5.7	ACCTTCCCGCAAGGTTAAGGT
Proteus mirabilis HI4320	PMI2172	-33	6.2	ACCTTTCCGCAAGGGGAAGGT
Photorhabdus luminescens subsp. laumondii TTO1	plu3823	-33	6	ACCTTCCCTCAAGGGTAAGGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --