Propagation of Zur regulog to Erwinia carotovora subsp. atroseptica SCRI1043

Reference regulog properties
Source regulog:	Zur - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Erwinia carotovora subsp. atroseptica SCRI1043
Orthologous TF(s)	ECA0632
Regulated genes	5

Built upon 65 sites [see more]

Predicted regulatory interactions in *Erwinia carotovora subsp. atroseptica SCRI1043*
	Locus tag	Position	Score	Sequence
Position: -31 Score: 6 Sequence: GATATGTTATAACATAACAATTG Locus tag: ECA1168
	ECA1168	-31	6	GATATGTTATAACATAACAATTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: rpmE2
Ortholog function: 50S ribosomal protein L31 paralog
Escherichia coli str. K-12 substr. MG1655	b0296	-34	5.6	TTATGGTTATGTTATAACATAAC
Salmonella typhimurium LT2	STM0469	-35	5.8	TTATTGTTATGTTATAACATAAT
Citrobacter koseri ATCC BAA-895	CKO_02696	-35	5.5	TTATTGTTACGTTATAACATAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00435	-35	5.5	TTATTGTTATGTTATAACGTAAT
Enterobacter sp. 638	Ent638_0934	-37	5.6	CTTTTGTTATGTTATAACAAAAC
Erwinia amylovora ATCC 49946	EAM_1015	-36	6	TTTTGGTTATATTATAACATATC
Yersinia pestis KIM	y1048	-36	5.9	ATGATGTTACATTATAACATACT
Serratia proteamaculans 568	Spro_1125	-36	6.2	TTATTGTTATAGTATAACATTAC
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1168	-31	6	GATATGTTATAACATAACAATTG
Proteus mirabilis HI4320	PMI3379	-38	6.5	ATATTGTTATATTATAACATTAC
Photorhabdus luminescens subsp. laumondii TTO1	plu0036	-32	6.2	GTAATGTTATATTATTACAATTT

Position: -53 Score: 6.3 Sequence: GTAATGTTATAATATAACAAACA Locus tag: ECA2484
	ECA2484	-53	6.3	GTAATGTTATAATATAACAAACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: high-affinity zinc ABC transporter, substrate-binding protein
Escherichia coli str. K-12 substr. MG1655	b1857	-52	6.5	GAAATGTTATAATATCACACTTC
Salmonella typhimurium LT2	STM1891	-52	6.6	AGAATGTTATAATATCACATTTC
Citrobacter koseri ATCC BAA-895	CKO_01106	-37	6.6	AGAATGTTATAATATCACATTTC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02372	-100	6.3	TGAATGTTATAATATCACATCAC
Enterobacter sp. 638	Ent638_2426	-52	6.1	CGAATGTTATAATATCACATCCA
Erwinia amylovora ATCC 49946	EAM_2000	-52	5.9	CAAATGTTATAATATCACAAAAT
Yersinia pestis KIM	y2249	-51	5.6	TGAATGTTATAATATTACGCTTT
Serratia proteamaculans 568	Spro_2773	-51	5.7	CGAATGTTATAATATCACGCCTC
Erwinia carotovora subsp. atroseptica SCRI1043	ECA2484	-53	6.3	GTAATGTTATAATATAACAAACA
Edwardsiella tarda EIB202	ETAE_1443	-50	6.6	GGAATGTTATAATATAACGTTTC
Proteus mirabilis HI4320	PMI1152	-50	6.7	GAAACGTTATAATATAACATTTC
Photorhabdus luminescens subsp. laumondii TTO1	plu2115	-51	6.6	GAGATGTTATAATATAACAATTC

Position: -46 Score: 6.4 Sequence: TGTTTGTTATATTATAACATTAC Locus tag: ECA2485
	ECA2485	-46	6.4	TGTTTGTTATATTATAACATTAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC
Ortholog function: high-affinity zinc ABC transporter, ATP-binding protein
Escherichia coli str. K-12 substr. MG1655	b1858	-49	6.5	GAAGTGTGATATTATAACATTTC
Salmonella typhimurium LT2	STM1892.S	-49	6.7	GAAATGTGATATTATAACATTCT
Citrobacter koseri ATCC BAA-895	CKO_01105	-49	6.7	GAAATGTGATATTATAACATTCT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02373	-49	6.4	GTGATGTGATATTATAACATTCA
Enterobacter sp. 638	Ent638_2427	-48	6.2	TGGATGTGATATTATAACATTCG
Erwinia amylovora ATCC 49946	EAM_2001	-48	6.1	ATTTTGTGATATTATAACATTTG
Yersinia pestis KIM	y2250	-47	5.7	AAAGCGTAATATTATAACATTCA
Serratia proteamaculans 568	Spro_2774	-50	5.8	GAGGCGTGATATTATAACATTCG
Erwinia carotovora subsp. atroseptica SCRI1043	ECA2485	-46	6.4	TGTTTGTTATATTATAACATTAC
Edwardsiella tarda EIB202	ETAE_1442	-72	6.7	GAAACGTTATATTATAACATTCC
Proteus mirabilis HI4320	PMI1151	-47	6.7	GAAATGTTATATTATAACGTTTC
Photorhabdus luminescens subsp. laumondii TTO1	plu2114	-48	6.6	GAATTGTTATATTATAACATCTC

Position: -3 Score: 5.7 Sequence: ATAATGTTACATTATAACGCTTT Locus tag: ECA3248
	ECA3248	-3	5.7	ATAATGTTACATTATAACGCTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ECA3248
Ortholog function: ABC-type uncharacterized transport system, periplasmic component
Yersinia pestis KIM	y1329	6	5.1	TATGTGTTACATTATAACGGTTT
Serratia proteamaculans 568	Spro_3632	-3	5.3	TTTATGTTACTTTATAACAATAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA3248	-3	5.7	ATAATGTTACATTATAACGCTTT
Proteus mirabilis HI4320	PMI1519	-42	6.1	GTGATGTTATATTATAACAAAAT

Position: -55 Score: 5.4 Sequence: AATTTGGTATGTTATAACATACC Position: -50 Score: 5.3 Sequence: GGTATGTTATAACATACCATCAT Locus tag: ECA4254
	ECA4254	-55	5.4	AATTTGGTATGTTATAACATACC
		-50	5.3	GGTATGTTATAACATACCATCAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ECA4254
Ortholog function: predicted zinc-regulated ABC transporter, ATP-binding protein
Citrobacter koseri ATCC BAA-895	CKO_00850	-29	6.1	TAATTGTTATGATATAACATATC
Erwinia carotovora subsp. atroseptica SCRI1043	ECA4254	-55	5.4	AATTTGGTATGTTATAACATACC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of Zur regulog to Erwinia carotovora subsp. atroseptica SCRI1043

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --