Propagation of GalR/GalS regulog to Dickeya dadantii Ech703

Reference regulog properties
Source regulog:	GalR/GalS - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Dickeya dadantii Ech703
Orthologous TF(s)	Dd703_1062, Dd703_0761
Regulated genes	1

Built upon 78 sites [see more]

Predicted regulatory interactions in *Dickeya dadantii Ech703*
	Locus tag	Position	Score	Sequence
Position: -126 Score: 5.1 Sequence: GTATGTAAGCGCTTTCAATG Locus tag: Dd703_1062
	Dd703_1062	-126	5.1	GTATGTAAGCGCTTTCAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: galS
Ortholog function: galactose operon repressor galS
Escherichia coli str. K-12 substr. MG1655	b2151	-113	5.5	GGCTGTAACCGTTTCCATTG
Salmonella typhimurium LT2	STM2191	-121	5.4	GGCTGTAACCGTTTCCATCC
Citrobacter koseri ATCC BAA-895	CKO_00640	-124	4.9	GCATGTAACCGTTTCCAGCC
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_02589	-127	5.2	GGATGTAAACGTTTCCAGCC
Enterobacter sp. 638	Ent638_2751	-127	5.5	GGATGTAACCGTTTTCATCT
Erwinia amylovora ATCC 49946	EAM_2208	-128	4.9	GGCTGTAACCGTTTTCATGG
Serratia proteamaculans 568	Spro_1562	-102	5.4	GTATGTAAACGTTTTCTTTC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --