Propagation of LacI regulog to Dickeya dadantii Ech703
| Source regulog: | LacI - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Lactose utilization |
| Effector: | Allolactose |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Dickeya dadantii Ech703 |
| Orthologous TF(s) | Dd703_1262 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -65
Score: 6.9 Sequence: AAATGTGAGCGAATAACAAAT
Locus tag: Dd703_1261
|
||||
| Dd703_1261 | -65 | 6.9 | AAATGTGAGCGAATAACAAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: lacZ | ||||
| Ortholog function: Beta-galactosidase (EC 3.2.1.23) | ||||
| Escherichia coli str. K-12 substr. MG1655 | b0344 | -38 | 7.4 | AATTGTGAGCGGATAACAATT |
| Citrobacter koseri ATCC BAA-895 | CKO_02825 | -38 | 7 | AATTGTGAGCGAATAACAAAC |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_pKPN3p05871 | -37 | 7.2 | AAATGTGAGCGGATAACAATT |
| Enterobacter sp. 638 | Ent638_0928 | -29 | 6.3 | AATTGTGAGCGCTTCGCAAAG |
| Erwinia carotovora subsp. atroseptica SCRI1043 | ECA1490 | -73 | 7.4 | AATTGTGAGCGGATAACAATT |