Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SdaR regulog to Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191

Reference regulog properties
Source regulog: SdaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: SdaR
Regulation mode: activator
Biological process: Glucarate utilization; Galactarate utilization
Effector: Glycerate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191
Orthologous TF(s) SeKB_A2703, Sententerica_010100006041
Regulated genes 1
Built upon 31 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191
Locus tag Position Score Sequence
Position: -71
Score: 5.8
Sequence: TTTTGTGCATTTGCACAATG
Locus tag: Sententerica_010100006041
Sententerica_010100006041 -71 5.8 TTTTGTGCATTTGCACAATG
Supported by regulated orthologs from reference regulons
Ortholog gene name: sdaR
Ortholog function: Glycerate-responsive transcriptional regulator for hexarate utilization, SdaR family
Escherichia coli str. K-12 substr. MG1655 b0162 -69 5.3 CTTTAGGCATTTGCACAATG
Salmonella typhimurium LT2 STM0210 -71 5.8 TTTTGTGCATTTGCACAATG
Citrobacter koseri ATCC BAA-895 CKO_03205 -17 5.1 GTTTGTGCAGATGCACAATG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00177 -17 5.4 CTTAGTGCAAATGCACAATG
Enterobacter sp. 638 Ent638_0702 -71 5.3 CTTTGTGCATTCGCACAATG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA3300 -80 4.3 CTTTGTTAATTTGCACAATG