Propagation of NikR regulog to Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191

Reference regulog properties
Source regulog:	NikR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	NikR
Regulation mode:	repressor
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191
Orthologous TF(s)	SeKB_A3763
Regulated genes	2

Built upon 9 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Kentucky str. CDC 191*
	Locus tag	Position	Score	Sequence
Position: -101 Score: 6.5 Sequence: GTATGATGTTTTTAAAAGATCGTCATAC Locus tag: Sententerica_010100019346
	Sententerica_010100019346	-101	6.5	GTATGATGTTTTTAAAAGATCGTCATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: yntA
Ortholog function: predicted nickel ABC transporter, substrate-binding protein
Salmonella typhimurium LT2	STM1255	-101	6.5	GTATGATGTTTTTAAAAGATCGTCATAC
Edwardsiella tarda EIB202	ETAE_1580	-171	5.3	GTATGCAGAAGTAAGGAAAAGTGCATAC

Position: -79 Score: 6.6 Sequence: GTGTGACGTTTTAATAAAATGATCATAC Locus tag: Sententerica_010100022358
	Sententerica_010100022358	-79	6.6	GTGTGACGTTTTAATAAAATGATCATAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nxiA
Ortholog function: high-affinity nickel-transporter
Salmonella typhimurium LT2	STM2783	-79	6.2	GTGTGACGTTTTAATCAAATGATCATAC
Edwardsiella tarda EIB202	ETAE_2654	-120	6.9	GTATGACAATTTCATGAAAAGATCATAC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --