Propagation of EbgR regulog to Shigella dysenteriae Sd197
| Source regulog: | EbgR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Shigella dysenteriae Sd197 |
| Orthologous TF(s) | SDY_3259 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -201
Score: 5.7 Sequence: TAAAATTTTACTAAACTATAG
Locus tag: SDY_3259
|
||||
| SDY_3259 | -201 | 5.7 | TAAAATTTTACTAAACTATAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ebgR | ||||
| Ortholog function: Evolved beta-D-galactosidase transcriptional repressor, LacI family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b3075 | -201 | 5.7 | TAAAATTTTACTAAACTATAG |
| Serratia proteamaculans 568 | Spro_1972 | -223 | 5.9 | AAAATATTTAGTAAAAAATAC |