Propagation of XapR regulog to Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594

Reference regulog properties
Source regulog:	XapR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Xanthosine utilization
Effector:	Deoxyinosine; Xanthosine
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594
Orthologous TF(s)	SPC_1241
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594*
	Locus tag	Position	Score	Sequence
Position: -107 Score: 6 Sequence: TCGATATTAAATGGCTATTGA Locus tag: SPC_1238
	SPC_1238	-107	6	TCGATATTAAATGGCTATTGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: xapA
Ortholog function: Xanthosine phosphorylase (EC 2.4.2.1)
Citrobacter koseri ATCC BAA-895	CKO_00389	-120	6.2	TCAATATACATTTTATATCGA
Edwardsiella tarda EIB202	ETAE_2779	-115	4.4	TCCCTAGCAAATCAATACTGA
Enterobacter sp. 638	Ent638_2934	-121	5.2	TTGATACTGAAAGAGTATTGA
Escherichia coli str. K-12 substr. MG1655	b2407	-132	4.2	TTAATAGAGAAAAGATATAAA
		-107	5.9	TCGATATCGAATCGCTATTGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --