Propagation of YiaJ regulog to Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594

Reference regulog properties
Source regulog:	YiaJ - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	IclR
Regulation mode:	repressor
Biological process:	L-lyxose utilization
Effector:	Ascorbate-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594
Orthologous TF(s)	SPC_3747
Regulated genes	2

Built upon 8 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594*
	Locus tag	Position	Score	Sequence
Position: -168 Score: 6.2 Sequence: ATTCGAAATCTAGTTCCAAAT Locus tag: SPC_3747
	SPC_3747	-168	6.2	ATTCGAAATCTAGTTCCAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaJ
Ortholog function: transcriptional regulator of L-lyxose catabolism, IclR family
Escherichia coli str. K-12 substr. MG1655	b3574	-151	6.3	ATGCGAAACTTGATTTCAAAT
Salmonella typhimurium LT2	STM3667	-168	6.2	ATGCGAAATCTAGTTCCAAAT
Citrobacter koseri ATCC BAA-895	CKO_05032	-167	6.5	ATGCGAAATCTGATTTCAAAT

Position: -82 Score: 6 Sequence: ATTTGGAACTAGATTTCGAAT Locus tag: SPC_3748
	SPC_3748	-82	6	ATTTGGAACTAGATTTCGAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yiaK
Ortholog function: 2,3-diketo-L-gulonate dehydrogenase, NADH-dependent
Escherichia coli str. K-12 substr. MG1655	b3575	-70	6.4	ATTTGAAATCAAGTTTCGCAT
Salmonella typhimurium LT2	STM3668	-82	6	ATTTGGAACTAGATTTCGCAT
Citrobacter koseri ATCC BAA-895	CKO_05033	-72	6.5	ATTTGAAATCAGATTTCGCAT
Serratia proteamaculans 568	Spro_3933	-74	6.1	ATTTGAAATGCAATTCCGCAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --