Propagation of MarR regulog to Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594

Reference regulog properties
Source regulog:	MarR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Antibiotic resistance
Effector:	Salicylate; Tetracycline; Chloramphenicol
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594
Orthologous TF(s)	SPC_2208
Regulated genes	1

Built upon 10 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Paratyphi C strain RKS4594*
	Locus tag	Position	Score	Sequence
Position: -22 Score: 6.8 Sequence: ATTACTTGCCGGGGCAACCATT Locus tag: SPC_2208
	SPC_2208	-22	6.8	ATTACTTGCCGGGGCAACCATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: marR
Ortholog function: DNA-binding transcriptional repressor MarR
Escherichia coli str. K-12 substr. MG1655	b1530	-57	6.8	TATACTTGCCTGGGCAATATTA
		-22	6.3	ATTACTTGCCAGGGCAACTAAT
Salmonella typhimurium LT2	STM1520	-57	7	TATACTTGCCTGGGCAATAGTA
		-22	6.8	ATTACTTGCCGGGGCAACCATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --