Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NanR regulog to Edwardsiella tarda EIB202

Reference regulog properties
Source regulog: NanR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor (activator)
Biological process: Sialic acid utilization
Effector: N-acetylneuraminic acid
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Edwardsiella tarda EIB202
Orthologous TF(s) ETAE_1380
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Edwardsiella tarda EIB202
Locus tag Position Score Sequence
Position: -85
Score: 8
Sequence: CTGGTATAACAGGTATACAGGTA
Locus tag: ETAE_1381
ETAE_1381 -85 8 CTGGTATAACAGGTATACAGGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nanA
Ortholog function: N-acetylneuraminate lyase (EC 4.1.3.3)
Escherichia coli str. K-12 substr. MG1655 b3225 -60 8.2 CTGGTATAACAGGTATAAAGGTA
Salmonella typhimurium LT2 STM3339 -58 8.2 CTGGTATAACAGGTATAAAGGTA
Citrobacter koseri ATCC BAA-895 CKO_04629 -60 8.2 CTGGTATAACAGGTATAAAGGTA
Enterobacter sp. 638 Ent638_3661 -57 8.2 CTGGTATAACAGGTATAAAGGTA
Edwardsiella tarda EIB202 ETAE_1381 -85 8 CTGGTATAACAGGTATACAGGTA
© 2009-2020 RegPrecise