Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of RutR regulog to Salmonella enterica subsp. enterica serovar Newport str. SL254

Reference regulog properties
Source regulog: RutR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Pyrimidine utilization
Effector: Uracil
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Salmonella enterica subsp. enterica serovar Newport str. SL254
Orthologous TF(s) SNSL254_A1216
Regulated genes 1
Built upon 13 sites [see more]
Predicted regulatory interactions in Salmonella enterica subsp. enterica serovar Newport str. SL254
Locus tag Position Score Sequence
Position: -294
Score: 6.5
Sequence: ATTTGACCATTTGGTCCACT
Locus tag: SNSL254_A0070
SNSL254_A0070 -294 6.5 ATTTGACCATTTGGTCCACT
Supported by regulated orthologs from reference regulons
Ortholog gene name: carA
Ortholog function: Carbamoyl-phosphate synthase small chain (EC 6.3.5.5)
Escherichia coli str. K-12 substr. MG1655 b0032 -294 6.5 TTTTGACCATTTGGTCCACT
Salmonella typhimurium LT2 STM0066 -294 6.5 ATTTGACCATTTGGTCCACT
Citrobacter koseri ATCC BAA-895 CKO_03351 -268 6.4 TTTTGACCAAATGGTCCACT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00040 -267 6.4 TTTTGACCATCTGGTCCACT
Enterobacter sp. 638 Ent638_0591 -294 5.8 TTTTGACCATTTGGTCTGGT
Erwinia amylovora ATCC 49946 EAM_0660 -297 6.2 TTCTGACCATTTGGTCCACT