Propagation of SoxR regulog to Proteus mirabilis HI4320
| Source regulog: | SoxR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/Gamma |
| Propagated regulon: | |
| Target genome | Proteus mirabilis HI4320 |
| Orthologous TF(s) | PMI2705 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -46
Score: 7.4 Sequence: ACCTCAAGTTAACTTGAGGT
Locus tag: PMI2705
|
||||
| PMI2705 | -46 | 7.4 | ACCTCAAGTTAACTTGAGGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: soxR | ||||
| Ortholog function: Redox-sensitive transcriptional activator, MerR family | ||||
| Escherichia coli str. K-12 substr. MG1655 | b4063 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Salmonella typhimurium LT2 | STM4266 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Citrobacter koseri ATCC BAA-895 | CKO_03827 | -30 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04463 | -57 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Enterobacter sp. 638 | Ent638_0267 | -31 | 7.4 | TCCTCAAGTTAACTTGAGGT |
| Erwinia amylovora ATCC 49946 | EAM_0317 | -30 | 7.1 | TCCTCAAGTTTACTTGAGGT |