Propagation of MntR regulog to Chloroflexus aurantiacus J-10-fl
| Source regulog: | MntR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Chloroflexi |
| Propagated regulon: | |
| Target genome | Chloroflexus aurantiacus J-10-fl |
| Orthologous TF(s) | Caur_0100 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -40
Score: 5.8 Sequence: GATTTAGGTAAGGCTAAAAT
Locus tag: Caur_0197
|
||||
| Caur_0197 | -40 | 5.8 | GATTTAGGTAAGGCTAAAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntA | ||||
| Ortholog function: Manganese ABC transporter, periplasmic-binding protein | ||||
| Chloroflexus aggregans DSM 9485 | Cagg_3553 | -38 | 6 | ATTTTAGGTTAGGCTAAAAT |
| Chloroflexus sp. Y-400-fl | Chy400_0210 | -40 | 5.8 | GATTTAGGTAAGGCTAAAAT |
| Roseiflexus castenholzii DSM 13941 | Rcas_1724 | -55 | 5.9 | ATTTTAGGATTTCCAAAATT |
| Herpetosiphon aurantiacus ATCC 23779 | Haur_4030 | -51 | 5.8 | CTTTTAGGTATGCCTAAATA |
| Roseiflexus sp. RS-1 | RoseRS_3070 | -42 | 5.6 | GATTTAGGCAAGACAAAATT |