Propagation of BfrR regulog to Chloroflexus aurantiacus J-10-fl
| Source regulog: | BfrR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Chloroflexi |
| Propagated regulon: | |
| Target genome | Chloroflexus aurantiacus J-10-fl |
| Orthologous TF(s) | Caur_2731 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -4
Score: 6.2 Sequence: GTCAATGAACGACCAATCTC
Locus tag: Caur_2731
|
||||
| Caur_2731 | -4 | 6.2 | GTCAATGAACGACCAATCTC | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: bfrR | ||||
| Ortholog function: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family | ||||
| Chloroflexus sp. Y-400-fl | Chy400_2954 | -46 | 6.2 | GTCAATGAACGACCAATCTC |
| Chloroflexus aggregans DSM 9485 | Cagg_3715 | -46 | 6.4 | GTCAATGGACGACCAATCTC |