Propagation of BfrR regulog to Chloroflexus aurantiacus J-10-fl

Reference regulog properties
Source regulog:	BfrR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Chloroflexus aurantiacus J-10-fl
Orthologous TF(s)	Caur_2731
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Chloroflexus aurantiacus J-10-fl*
	Locus tag	Position	Score	Sequence
Position: -4 Score: 6.2 Sequence: GTCAATGAACGACCAATCTC Locus tag: Caur_2731
	Caur_2731	-4	6.2	GTCAATGAACGACCAATCTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: bfrR
Ortholog function: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Chloroflexus sp. Y-400-fl	Chy400_2954	-46	6.2	GTCAATGAACGACCAATCTC
Chloroflexus aggregans DSM 9485	Cagg_3715	-46	6.4	GTCAATGGACGACCAATCTC

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --