Propagation of YybR/YdeP regulog to Bacillus megaterium QM B1551
Source regulog: | YybR/YdeP - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | HxlR |
Regulation mode: | activator |
Biological process: | Multidrug resistance |
Effector: | |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus megaterium QM B1551 |
Orthologous TF(s) | BMQ_pBM70057, BMQ_3879, BMQ_3781 |
Regulated genes | 3 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -192
Score: 5.4 Sequence: CAGTATAAAAAAGTATACTA
Locus tag: BMQ_2331
|
||||
BMQ_2331 | -192 | 5.4 | CAGTATAAAAAAGTATACTA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yfkO | ||||
Ortholog function: Oxygen-insensitive NAD(P)H nitroreductase (EC 1.-.-.-) / Dihydropteridine reductase (EC 1.5.1.34) | ||||
Bacillus amyloliquefaciens FZB42 | RBAM_008000 | -100 | 5.5 | CAGTATCAAAATGAATACTA |
Bacillus licheniformis DSM 13 | BLi00813 | -117 | 6.3 | TAGTATAAAAAATGATACTA |
Bacillus subtilis subsp. subtilis str. 168 | BSU07830 | -103 | 6 | TGGTATCAAAATTGATACTA |
Paenibacillus sp. JDR-2 | Pjdr2_4453 | -145 | 6 | TAGTATCCTTTTTAATACTA |
Position: -36
Score: 5.9 Sequence: TAGTATAAAACTGTATACTA
Locus tag: BMQ_3781
|
||||
BMQ_3781 | -36 | 5.9 | TAGTATAAAACTGTATACTA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: yybR | ||||
Ortholog function: Transcriptional regulator, HxlR family | ||||
Bacillus amyloliquefaciens FZB42 | RBAM_037620 | -33 | 6 | TAGTATCAAAAAAGGTACTA |
Bacillus cereus ATCC 14579 | BC3320 | -42 | 6.3 | TAGTATCAAAAAAGATACTA |
Bacillus halodurans C-125 | BH0737 | -49 | 5.2 | TAGTTACATGTAGGTTACTA |
Bacillus subtilis subsp. subtilis str. 168 | BSU05290 | -35 | 6.2 | TAGTATCAAAAAGTATACTA |
Bacillus subtilis subsp. subtilis str. 168 | BSU40540 | -34 | 6 | TAGTATCAAAAAAGGTACTA |
Paenibacillus sp. JDR-2 | Pjdr2_4452 | -72 | 6 | TAGTATTAAAAAGGATACTA |