Propagation of NagR regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog:	NagR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus castenholzii DSM 13941
Orthologous TF(s)	Rcas_0477
Regulated genes	1

Built upon 5 sites [see more]

Predicted regulatory interactions in *Roseiflexus castenholzii DSM 13941*
	Locus tag	Position	Score	Sequence
Position: -132 Score: 6.9 Sequence: TTGTCAGTTCAATGGACTAACAC Locus tag: Rcas_0477
	Rcas_0477	-132	6.9	TTGTCAGTTCAATGGACTAACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: nagR
Ortholog function: Predicted N-acetyl-glucosamine repressor, ROK family
Chloroflexus sp. Y-400-fl	Chy400_1208	-39	6.8	TTGTTAGTTCATTGGACTATCTA
Herpetosiphon aurantiacus ATCC 23779	Haur_1182	-418	4.9	GTAATGGTTCATTGGGTTAACAA
		-23	4.3	TAGTAAATTCATTGGAATAAGTT
Roseiflexus castenholzii DSM 13941	Rcas_0477	-132	6.9	TTGTCAGTTCAATGGACTAACAC
Roseiflexus sp. RS-1	RoseRS_4247	-126	6.7	TTGTCAGTTCACTGAACTAATGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --