Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of HcpR regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog: HcpR - Chloroflexia
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Chloroflexi
Propagated regulon:
Target genome Roseiflexus castenholzii DSM 13941
Orthologous TF(s) Rcas_3897
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Roseiflexus castenholzii DSM 13941
Locus tag Position Score Sequence
Position: -111
Score: 6.5
Sequence: AACTTGCGCCAGCGCAACGA
Locus tag: Rcas_3898
Rcas_3898 -111 6.5 AACTTGCGCCAGCGCAACGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Rcas_3898
Ortholog function: Cytochrome c family protein involved in nitrosative stress
Chloroflexus aggregans DSM 9485 Cagg_2669 -86 6.8 AAGTTGCGCTAGCGCAACGT
Chloroflexus aggregans DSM 9485 Cagg_2026 -116 6.5 ATCTTGCGCTAGCGCAACGA
Roseiflexus castenholzii DSM 13941 Rcas_3898 -111 6.5 AACTTGCGCCAGCGCAACGA
Roseiflexus sp. RS-1 RoseRS_0596 -105 6.5 AACTTGCGCCAGCGCAACGA