Propagation of HcpR regulog to Roseiflexus castenholzii DSM 13941
| Source regulog: | HcpR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Chloroflexi |
| Propagated regulon: | |
| Target genome | Roseiflexus castenholzii DSM 13941 |
| Orthologous TF(s) | Rcas_3897 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -111
Score: 6.5 Sequence: AACTTGCGCCAGCGCAACGA
Locus tag: Rcas_3898
|
||||
| Rcas_3898 | -111 | 6.5 | AACTTGCGCCAGCGCAACGA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: Rcas_3898 | ||||
| Ortholog function: Cytochrome c family protein involved in nitrosative stress | ||||
| Chloroflexus aggregans DSM 9485 | Cagg_2669 | -86 | 6.8 | AAGTTGCGCTAGCGCAACGT |
| Chloroflexus aggregans DSM 9485 | Cagg_2026 | -116 | 6.5 | ATCTTGCGCTAGCGCAACGA |
| Roseiflexus castenholzii DSM 13941 | Rcas_3898 | -111 | 6.5 | AACTTGCGCCAGCGCAACGA |
| Roseiflexus sp. RS-1 | RoseRS_0596 | -105 | 6.5 | AACTTGCGCCAGCGCAACGA |