Propagation of Zur regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog:	Zur - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus castenholzii DSM 13941
Orthologous TF(s)	Rcas_1649, Rcas_3901
Regulated genes	2

Built upon 19 sites [see more]

Predicted regulatory interactions in *Roseiflexus castenholzii DSM 13941*
	Locus tag	Position	Score	Sequence
Position: -122 Score: 5.3 Sequence: TATCCATACCACATATCAATA Locus tag: Rcas_1591
	Rcas_1591	-122	5.3	TATCCATACCACATATCAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: Zinc ABC transporter, periplasmic-binding protein ZnuA
Chloroflexus aggregans DSM 9485	Cagg_2043	-35	5.9	AATTGAAACATAGTTTCATTA
Chloroflexus sp. Y-400-fl	Chy400_2148	-35	6.1	TTTTGAAACAATGTTTCATTA
Roseiflexus castenholzii DSM 13941	Rcas_1591	-122	5.3	TATCCATACCACATATCAATA
Herpetosiphon aurantiacus ATCC 23779	Haur_2064	-95	6.2	TAATGATACAAAATATCATTA
Roseiflexus sp. RS-1	RoseRS_1258	-124	5.5	TATAAAAACGAAGTATCAATA

Position: -58 Score: 4.3 Sequence: CATTGATATACACTATCATCA Locus tag: Rcas_2945
	Rcas_2945	-58	4.3	CATTGATATACACTATCATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: yciC
Ortholog function: Putative metal chaperone involved in Zn homeostasis, COG0523 family
Chloroflexus aggregans DSM 9485	Cagg_0608	-79	5.8	TAATGATATAACGTATCATTT
		-20	4.5	AATCGAGATAAGGTATCAATG
Roseiflexus castenholzii DSM 13941	Rcas_2945	-58	4.3	CATTGATATACACTATCATCA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --