Propagation of FetR regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog:	FetR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Iron ion, (Fe2+)
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus castenholzii DSM 13941
Orthologous TF(s)	Rcas_4363
Regulated genes	3

Built upon 13 sites [see more]

Predicted regulatory interactions in *Roseiflexus castenholzii DSM 13941*
	Locus tag	Position	Score	Sequence
Position: -98 Score: 6.3 Sequence: TTATTAGCATATGCTAACAT Locus tag: Rcas_0821
	Rcas_0821	-98	6.3	TTATTAGCATATGCTAACAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: RoseRS_4469
Ortholog function: hypothetical protein
Roseiflexus sp. RS-1	RoseRS_4469	-141	6	TTATTAGGATATGCTAACCA
Roseiflexus castenholzii DSM 13941	Rcas_0821	-98	6.3	TTATTAGCATATGCTAACAT
Chloroflexus sp. Y-400-fl	Chy400_0685	-92	5.8	TTATTAGAGTATGCTAACCG

Position: -159 Score: 5.5 Sequence: ATGTTAGAGTAACCTAACAC Locus tag: Rcas_3171
	Rcas_3171	-159	5.5	ATGTTAGAGTAACCTAACAC
Supported by regulated orthologs from reference regulons
Ortholog gene name: fbpA
Ortholog function: Ferric iron ABC transporter, periplasmic-binding protein
Roseiflexus sp. RS-1	RoseRS_2294	-157	6	ATGTTAGAGTAATCTAACAA
Roseiflexus castenholzii DSM 13941	Rcas_3171	-159	5.5	ATGTTAGAGTAACCTAACAC

Position: -123 Score: 5.9 Sequence: TTATTAGACTATACTAACTT Locus tag: Rcas_4373
	Rcas_4373	-123	5.9	TTATTAGACTATACTAACTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: hmuV
Ortholog function: Heme ABC transporter, ATPase component HmuV
Roseiflexus sp. RS-1	RoseRS_3564	-109	6	TTATTAGACTATACTAACCA
Roseiflexus castenholzii DSM 13941	Rcas_4373	-123	5.9	TTATTAGACTATACTAACTT
Chloroflexus sp. Y-400-fl	Chy400_2616	-57	5.8	AAATTAGAGTATTCTAATAG
Chloroflexus aggregans DSM 9485	Cagg_3308	-57	6	AAATTAGTATATTCTAACTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --