Propagation of MntR regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog:	MntR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus castenholzii DSM 13941
Orthologous TF(s)	Rcas_3322
Regulated genes	2

Built upon 9 sites [see more]

Predicted regulatory interactions in *Roseiflexus castenholzii DSM 13941*
	Locus tag	Position	Score	Sequence
Position: -55 Score: 5.9 Sequence: ATTTTAGGATTTCCAAAATT Locus tag: Rcas_1724
	Rcas_1724	-55	5.9	ATTTTAGGATTTCCAAAATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntA
Ortholog function: Manganese ABC transporter, periplasmic-binding protein
Chloroflexus aggregans DSM 9485	Cagg_3553	-38	6	ATTTTAGGTTAGGCTAAAAT
Chloroflexus sp. Y-400-fl	Chy400_0210	-40	5.8	GATTTAGGTAAGGCTAAAAT
Roseiflexus castenholzii DSM 13941	Rcas_1724	-55	5.9	ATTTTAGGATTTCCAAAATT
Herpetosiphon aurantiacus ATCC 23779	Haur_4030	-51	5.8	CTTTTAGGTATGCCTAAATA
Roseiflexus sp. RS-1	RoseRS_3070	-42	5.6	GATTTAGGCAAGACAAAATT

Position: -9 Score: 5.8 Sequence: GTTTTAGGAATGCCTAAATA Locus tag: Rcas_3322
	Rcas_3322	-9	5.8	GTTTTAGGAATGCCTAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntR
Ortholog function: Mn-dependent transcriptional regulator MntR, DtxR family
Roseiflexus castenholzii DSM 13941	Rcas_3322	-9	5.8	GTTTTAGGAATGCCTAAATA
Roseiflexus sp. RS-1	RoseRS_3986	-29	5.5	GTTTTAGGTCTACCTAAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --