Propagation of ModR regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog:	ModR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus castenholzii DSM 13941
Orthologous TF(s)	Rcas_2179
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Roseiflexus castenholzii DSM 13941*
	Locus tag	Position	Score	Sequence
Position: -27 Score: 5.3 Sequence: TATATTTATTTTTTGAATAGT Locus tag: Rcas_2179
	Rcas_2179	-27	5.3	TATATTTATTTTTTGAATAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: modR
Ortholog function: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Chloroflexus aggregans DSM 9485	Cagg_1371	-82	6.1	AGTACTCACATCGTGAATATA
Chloroflexus sp. Y-400-fl	Chy400_2685	-102	6.9	AGTATTCACATTGTGAATACT
Roseiflexus castenholzii DSM 13941	Rcas_2179	-27	5.3	TATATTTATTTTTTGAATAGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --