Propagation of Caur_3401 regulog to Roseiflexus castenholzii DSM 13941

Reference regulog properties
Source regulog:	Caur_3401 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus castenholzii DSM 13941
Orthologous TF(s)	Rcas_4171
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Roseiflexus castenholzii DSM 13941*
	Locus tag	Position	Score	Sequence
Position: -156 Score: 6.6 Sequence: ATTTTACTGTATAGTAGTCT Locus tag: Rcas_4170
	Rcas_4170	-156	6.6	ATTTTACTGTATAGTAGTCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrB
Ortholog function: Probable multidrug efflux system from RND family, AcrB pore domain
Chloroflexus aggregans DSM 9485	Cagg_0354	-69	7	ACTTTACGGTATAGTAAAAA
Chloroflexus sp. Y-400-fl	Chy400_3664	-69	7	ACTTTACGGTATAGTAAAAA
Roseiflexus castenholzii DSM 13941	Rcas_4170	-156	6.6	ATTTTACTGTATAGTAGTCT
Roseiflexus sp. RS-1	RoseRS_4303	-136	6.6	ATTTTACTGTATAGTAGTCT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --