Propagation of Caur_1157 regulog to Chloroflexus aggregans DSM 9485

Reference regulog properties
Source regulog:	Caur_1157 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Chloroflexus aggregans DSM 9485
Orthologous TF(s)	Cagg_1685
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Chloroflexus aggregans DSM 9485*
	Locus tag	Position	Score	Sequence
Position: -119 Score: 5.6 Sequence: CCCTGGAAGCGCTTTCACGG Locus tag: Cagg_1685
	Cagg_1685	-119	5.6	CCCTGGAAGCGCTTTCACGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: Caur_1157
Ortholog function: Predicted transcriptional regulator for beta-glucoside utilization, LacI family
Chloroflexus sp. Y-400-fl	Chy400_1181	-117	5.6	GACTGGAAGCGCTTTCACGG
Chloroflexus aggregans DSM 9485	Cagg_1685	-119	5.6	CCCTGGAAGCGCTTTCACGG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --