Propagation of HcpR regulog to Chloroflexus aggregans DSM 9485

Reference regulog properties
Source regulog:	HcpR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Chloroflexus aggregans DSM 9485
Orthologous TF(s)	Cagg_2668, Cagg_2027
Regulated genes	2

Built upon 4 sites [see more]

Predicted regulatory interactions in *Chloroflexus aggregans DSM 9485*
	Locus tag	Position	Score	Sequence
Position: -116 Score: 6.5 Sequence: ATCTTGCGCTAGCGCAACGA Locus tag: Cagg_2026
	Cagg_2026	-116	6.5	ATCTTGCGCTAGCGCAACGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Rcas_3898
Ortholog function: Cytochrome c family protein involved in nitrosative stress
Chloroflexus aggregans DSM 9485	Cagg_2669	-86	6.8	AAGTTGCGCTAGCGCAACGT
Chloroflexus aggregans DSM 9485	Cagg_2026	-116	6.5	ATCTTGCGCTAGCGCAACGA
Roseiflexus castenholzii DSM 13941	Rcas_3898	-111	6.5	AACTTGCGCCAGCGCAACGA
Roseiflexus sp. RS-1	RoseRS_0596	-105	6.5	AACTTGCGCCAGCGCAACGA

Position: -86 Score: 6.8 Sequence: AAGTTGCGCTAGCGCAACGT Locus tag: Cagg_2669
	Cagg_2669	-86	6.8	AAGTTGCGCTAGCGCAACGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Rcas_3898
Ortholog function: Cytochrome c family protein involved in nitrosative stress
Chloroflexus aggregans DSM 9485	Cagg_2669	-86	6.8	AAGTTGCGCTAGCGCAACGT
Chloroflexus aggregans DSM 9485	Cagg_2026	-116	6.5	ATCTTGCGCTAGCGCAACGA
Roseiflexus castenholzii DSM 13941	Rcas_3898	-111	6.5	AACTTGCGCCAGCGCAACGA
Roseiflexus sp. RS-1	RoseRS_0596	-105	6.5	AACTTGCGCCAGCGCAACGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --