Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModR regulog to Chloroflexus aggregans DSM 9485

Reference regulog properties
Source regulog: ModR - Chloroflexia
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Chloroflexi
Propagated regulon:
Target genome Chloroflexus aggregans DSM 9485
Orthologous TF(s) Cagg_1371
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Chloroflexus aggregans DSM 9485
Locus tag Position Score Sequence
Position: -82
Score: 6.1
Sequence: AGTACTCACATCGTGAATATA
Locus tag: Cagg_1371
Cagg_1371 -82 6.1 AGTACTCACATCGTGAATATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: modR
Ortholog function: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Chloroflexus aggregans DSM 9485 Cagg_1371 -82 6.1 AGTACTCACATCGTGAATATA
Chloroflexus sp. Y-400-fl Chy400_2685 -102 6.9 AGTATTCACATTGTGAATACT
Roseiflexus castenholzii DSM 13941 Rcas_2179 -27 5.3 TATATTTATTTTTTGAATAGT
© 2009-2020 RegPrecise