Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of BfrR regulog to Chloroflexus aggregans DSM 9485

Reference regulog properties
Source regulog: BfrR - Chloroflexia
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructooligosaccharides utilization
Effector:
Phylum: Chloroflexi
Propagated regulon:
Target genome Chloroflexus aggregans DSM 9485
Orthologous TF(s) Cagg_3715
Regulated genes 1
Built upon 2 sites [see more]
Predicted regulatory interactions in Chloroflexus aggregans DSM 9485
Locus tag Position Score Sequence
Position: -46
Score: 6.4
Sequence: GTCAATGGACGACCAATCTC
Locus tag: Cagg_3715
Cagg_3715 -46 6.4 GTCAATGGACGACCAATCTC
Supported by regulated orthologs from reference regulons
Ortholog gene name: bfrR
Ortholog function: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family
Chloroflexus sp. Y-400-fl Chy400_2954 -46 6.2 GTCAATGAACGACCAATCTC
Chloroflexus aggregans DSM 9485 Cagg_3715 -46 6.4 GTCAATGGACGACCAATCTC