Propagation of AcrR regulog to Chloroflexus aggregans DSM 9485
Source regulog: | AcrR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Multidrug efflux; Multidrug resistance |
Effector: | |
Phylum: | Chloroflexi |
Propagated regulon: | |
Target genome | Chloroflexus aggregans DSM 9485 |
Orthologous TF(s) | Cagg_2437, Cagg_0421 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -51
Score: 6.1 Sequence: GTTACCGACCGGTCGGTCGGTTTT
Locus tag: Cagg_0420
|
||||
Cagg_0420 | -51 | 6.1 | GTTACCGACCGGTCGGTCGGTTTT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: Cagg_0420 | ||||
Ortholog function: Multidrug transporter, MFS superfamily | ||||
Chloroflexus aggregans DSM 9485 | Cagg_0420 | -51 | 6.1 | GTTACCGACCGGTCGGTCGGTTTT |
Chloroflexus sp. Y-400-fl | Chy400_3788 | -54 | 6.2 | AATACTTACCGACCGGTCGGTTGG |
Roseiflexus castenholzii DSM 13941 | Rcas_2058 | -41 | 6.3 | ACTCCTTACCGACCGGTAAGGAAA |
Position: -44
Score: 6.9 Sequence: ATTACTTACCGGTCGGTAAGAATT
Locus tag: Cagg_2437
|
||||
Cagg_2437 | -44 | 6.9 | ATTACTTACCGGTCGGTAAGAATT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: acrR | ||||
Ortholog function: Predicted transcriptional regulator of multidrug efflux transporter, TetR family | ||||
Chloroflexus aggregans DSM 9485 | Cagg_2437 | -44 | 6.9 | ATTACTTACCGGTCGGTAAGAATT |
Chloroflexus aggregans DSM 9485 | Cagg_0421 | -51 | 6.1 | GTTACCGACCGGTCGGTCGGTTTT |
Chloroflexus sp. Y-400-fl | Chy400_1090 | -48 | 6.9 | ATTACTTACCGGTCGGTAAGAATT |
Roseiflexus castenholzii DSM 13941 | Rcas_0269 | -86 | 6.7 | ATTCCTGACCGTTCGGTAAAGTGA |
Roseiflexus sp. RS-1 | RoseRS_0266 | -94 | 6.7 | ATTCCTGACCGTTCGGTAAAGTGG |