Propagation of Caur_3587 regulog to Herpetosiphon aurantiacus ATCC 23779

Reference regulog properties
Source regulog:	Caur_3587 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Herpetosiphon aurantiacus ATCC 23779
Orthologous TF(s)	Haur_0112
Regulated genes	1

Built upon 11 sites [see more]

Predicted regulatory interactions in *Herpetosiphon aurantiacus ATCC 23779*
	Locus tag	Position	Score	Sequence
Position: -50 Score: 5.5 Sequence: ATATTGAATTAATTCGATAA Locus tag: Haur_0112
	Haur_0112	-50	5.5	ATATTGAATTAATTCGATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Caur_3587
Ortholog function: transcriptional regulator, ArsR family
Herpetosiphon aurantiacus ATCC 23779	Haur_0112	-50	5.5	ATATTGAATTAATTCGATAA
Roseiflexus castenholzii DSM 13941	Rcas_2310	-52	6.6	ATATTGACAATCTTCAATAT
Roseiflexus sp. RS-1	RoseRS_1223	-22	6.5	ATATTGACATTCTTCAATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --