Propagation of Zur2 regulog to Herpetosiphon aurantiacus ATCC 23779

Reference regulog properties
Source regulog:	Zur2 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Herpetosiphon aurantiacus ATCC 23779
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 10 sites [see more]

Predicted regulatory interactions in *Herpetosiphon aurantiacus ATCC 23779*
	Locus tag	Position	Score	Sequence
Position: -83 Score: 5.3 Sequence: ATAATGATACATTATATCAATAT Position: -21 Score: 5.3 Sequence: ATAATGATATATAGTATCAATAT Locus tag: Haur_4472
	Haur_4472	-83	5.3	ATAATGATACATTATATCAATAT
		-21	5.3	ATAATGATATATAGTATCAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: Rcas_3893
Ortholog function: hypothetical protein
Roseiflexus castenholzii DSM 13941	Rcas_3893	-63	5	TCGTTGAAAGTAACTATCATCTG
Roseiflexus sp. RS-1	RoseRS_0845	-61	5.8	AAAATGGTAGTTGCTATCATTGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --