Propagation of MntR regulog to Herpetosiphon aurantiacus ATCC 23779

Reference regulog properties
Source regulog:	MntR - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Herpetosiphon aurantiacus ATCC 23779
Orthologous TF(s)	Haur_4031
Regulated genes	1

Built upon 9 sites [see more]

Predicted regulatory interactions in *Herpetosiphon aurantiacus ATCC 23779*
	Locus tag	Position	Score	Sequence
Position: -51 Score: 5.8 Sequence: CTTTTAGGTATGCCTAAATA Locus tag: Haur_4030
	Haur_4030	-51	5.8	CTTTTAGGTATGCCTAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntA
Ortholog function: Manganese ABC transporter, periplasmic-binding protein
Chloroflexus aggregans DSM 9485	Cagg_3553	-38	6	ATTTTAGGTTAGGCTAAAAT
Chloroflexus sp. Y-400-fl	Chy400_0210	-40	5.8	GATTTAGGTAAGGCTAAAAT
Roseiflexus castenholzii DSM 13941	Rcas_1724	-55	5.9	ATTTTAGGATTTCCAAAATT
Herpetosiphon aurantiacus ATCC 23779	Haur_4030	-51	5.8	CTTTTAGGTATGCCTAAATA
Roseiflexus sp. RS-1	RoseRS_3070	-42	5.6	GATTTAGGCAAGACAAAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --