Propagation of ModR regulog to Thermobaculum terrenum ATCC BAA-798
| Source regulog: | ModR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Chloroflexi |
| Propagated regulon: | |
| Target genome | Thermobaculum terrenum ATCC BAA-798 |
| Orthologous TF(s) | Tter_1318 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -52
Score: 6.2 Sequence: TGTATTCAAAGTTTGAATAGT
Locus tag: Tter_1318
|
||||
| Tter_1318 | -52 | 6.2 | TGTATTCAAAGTTTGAATAGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: modR | ||||
| Ortholog function: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family | ||||
| Chloroflexus aggregans DSM 9485 | Cagg_1371 | -82 | 6.1 | AGTACTCACATCGTGAATATA |
| Chloroflexus sp. Y-400-fl | Chy400_2685 | -102 | 6.9 | AGTATTCACATTGTGAATACT |
| Roseiflexus castenholzii DSM 13941 | Rcas_2179 | -27 | 5.3 | TATATTTATTTTTTGAATAGT |