Propagation of Rcas_3562 regulog to Roseiflexus sp. RS-1

Reference regulog properties
Source regulog:	Rcas_3562 - Chloroflexia
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:
Phylum:	Chloroflexi
Propagated regulon:
Target genome	Roseiflexus sp. RS-1
Orthologous TF(s)	RoseRS_1355
Regulated genes	1

Built upon 2 sites [see more]

Predicted regulatory interactions in *Roseiflexus sp. RS-1*
	Locus tag	Position	Score	Sequence
Position: -47 Score: 7.1 Sequence: TGTCCTGCATCCTATGCAATAAGACA Locus tag: RoseRS_1355
	RoseRS_1355	-47	7.1	TGTCCTGCATCCTATGCAATAAGACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: Rcas_3562
Ortholog function: Transcriptional regulator, GntR family
Roseiflexus castenholzii DSM 13941	Rcas_3562	-44	7.4	TGTCTTATATCCTATGCCATAGGACA
Roseiflexus sp. RS-1	RoseRS_1355	-47	7.1	TGTCCTGCATCCTATGCAATAAGACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --