Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of AcrR regulog to Roseiflexus sp. RS-1

Reference regulog properties
Source regulog: AcrR - Chloroflexia
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug efflux; Multidrug resistance
Effector:
Phylum: Chloroflexi
Propagated regulon:
Target genome Roseiflexus sp. RS-1
Orthologous TF(s) RoseRS_0266
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Roseiflexus sp. RS-1
Locus tag Position Score Sequence
Position: -94
Score: 6.7
Sequence: ATTCCTGACCGTTCGGTAAAGTGG
Locus tag: RoseRS_0266
RoseRS_0266 -94 6.7 ATTCCTGACCGTTCGGTAAAGTGG
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrR
Ortholog function: Predicted transcriptional regulator of multidrug efflux transporter, TetR family
Chloroflexus aggregans DSM 9485 Cagg_2437 -44 6.9 ATTACTTACCGGTCGGTAAGAATT
Chloroflexus aggregans DSM 9485 Cagg_0421 -51 6.1 GTTACCGACCGGTCGGTCGGTTTT
Chloroflexus sp. Y-400-fl Chy400_1090 -48 6.9 ATTACTTACCGGTCGGTAAGAATT
Roseiflexus castenholzii DSM 13941 Rcas_0269 -86 6.7 ATTCCTGACCGTTCGGTAAAGTGA
Roseiflexus sp. RS-1 RoseRS_0266 -94 6.7 ATTCCTGACCGTTCGGTAAAGTGG