Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Caur_3401 regulog to Roseiflexus sp. RS-1

Reference regulog properties
Source regulog: Caur_3401 - Chloroflexia
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Chloroflexi
Propagated regulon:
Target genome Roseiflexus sp. RS-1
Orthologous TF(s) RoseRS_4304
Regulated genes 1
Built upon 4 sites [see more]
Predicted regulatory interactions in Roseiflexus sp. RS-1
Locus tag Position Score Sequence
Position: -136
Score: 6.6
Sequence: ATTTTACTGTATAGTAGTCT
Locus tag: RoseRS_4303
RoseRS_4303 -136 6.6 ATTTTACTGTATAGTAGTCT
Supported by regulated orthologs from reference regulons
Ortholog gene name: acrB
Ortholog function: Probable multidrug efflux system from RND family, AcrB pore domain
Chloroflexus aggregans DSM 9485 Cagg_0354 -69 7 ACTTTACGGTATAGTAAAAA
Chloroflexus sp. Y-400-fl Chy400_3664 -69 7 ACTTTACGGTATAGTAAAAA
Roseiflexus castenholzii DSM 13941 Rcas_4170 -156 6.6 ATTTTACTGTATAGTAGTCT
Roseiflexus sp. RS-1 RoseRS_4303 -136 6.6 ATTTTACTGTATAGTAGTCT