Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Chloroflexus sp. Y-400-fl

Reference regulog properties
Source regulog: Zur - Chloroflexia
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Chloroflexi
Propagated regulon:
Target genome Chloroflexus sp. Y-400-fl
Orthologous TF(s) Chy400_1857
Regulated genes 1
Built upon 19 sites [see more]
Predicted regulatory interactions in Chloroflexus sp. Y-400-fl
Locus tag Position Score Sequence
Position: -35
Score: 6.1
Sequence: TTTTGAAACAATGTTTCATTA
Locus tag: Chy400_2148
Chy400_2148 -35 6.1 TTTTGAAACAATGTTTCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuA
Ortholog function: Zinc ABC transporter, periplasmic-binding protein ZnuA
Chloroflexus aggregans DSM 9485 Cagg_2043 -35 5.9 AATTGAAACATAGTTTCATTA
Chloroflexus sp. Y-400-fl Chy400_2148 -35 6.1 TTTTGAAACAATGTTTCATTA
Roseiflexus castenholzii DSM 13941 Rcas_1591 -122 5.3 TATCCATACCACATATCAATA
Herpetosiphon aurantiacus ATCC 23779 Haur_2064 -95 6.2 TAATGATACAAAATATCATTA
Roseiflexus sp. RS-1 RoseRS_1258 -124 5.5 TATAAAAACGAAGTATCAATA
© 2009-2020 RegPrecise