Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Chloroflexus sp. Y-400-fl

Reference regulog properties
Source regulog: MntR - Chloroflexia
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Chloroflexi
Propagated regulon:
Target genome Chloroflexus sp. Y-400-fl
Orthologous TF(s) Chy400_0107
Regulated genes 1
Built upon 9 sites [see more]
Predicted regulatory interactions in Chloroflexus sp. Y-400-fl
Locus tag Position Score Sequence
Position: -40
Score: 5.8
Sequence: GATTTAGGTAAGGCTAAAAT
Locus tag: Chy400_0210
Chy400_0210 -40 5.8 GATTTAGGTAAGGCTAAAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntA
Ortholog function: Manganese ABC transporter, periplasmic-binding protein
Chloroflexus aggregans DSM 9485 Cagg_3553 -38 6 ATTTTAGGTTAGGCTAAAAT
Chloroflexus sp. Y-400-fl Chy400_0210 -40 5.8 GATTTAGGTAAGGCTAAAAT
Roseiflexus castenholzii DSM 13941 Rcas_1724 -55 5.9 ATTTTAGGATTTCCAAAATT
Herpetosiphon aurantiacus ATCC 23779 Haur_4030 -51 5.8 CTTTTAGGTATGCCTAAATA
Roseiflexus sp. RS-1 RoseRS_3070 -42 5.6 GATTTAGGCAAGACAAAATT