Propagation of MntR regulog to Chloroflexus sp. Y-400-fl
Source regulog: | MntR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | DtxR |
Regulation mode: | repressor |
Biological process: | Manganese homeostasis |
Effector: | Manganese ion, (Mn2+) |
Phylum: | Chloroflexi |
Propagated regulon: | |
Target genome | Chloroflexus sp. Y-400-fl |
Orthologous TF(s) | Chy400_0107 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -40
Score: 5.8 Sequence: GATTTAGGTAAGGCTAAAAT
Locus tag: Chy400_0210
|
||||
Chy400_0210 | -40 | 5.8 | GATTTAGGTAAGGCTAAAAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: mntA | ||||
Ortholog function: Manganese ABC transporter, periplasmic-binding protein | ||||
Chloroflexus aggregans DSM 9485 | Cagg_3553 | -38 | 6 | ATTTTAGGTTAGGCTAAAAT |
Chloroflexus sp. Y-400-fl | Chy400_0210 | -40 | 5.8 | GATTTAGGTAAGGCTAAAAT |
Roseiflexus castenholzii DSM 13941 | Rcas_1724 | -55 | 5.9 | ATTTTAGGATTTCCAAAATT |
Herpetosiphon aurantiacus ATCC 23779 | Haur_4030 | -51 | 5.8 | CTTTTAGGTATGCCTAAATA |
Roseiflexus sp. RS-1 | RoseRS_3070 | -42 | 5.6 | GATTTAGGCAAGACAAAATT |