Propagation of BfrR regulog to Chloroflexus sp. Y-400-fl
Source regulog: | BfrR - Chloroflexia |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Fructooligosaccharides utilization |
Effector: | |
Phylum: | Chloroflexi |
Propagated regulon: | |
Target genome | Chloroflexus sp. Y-400-fl |
Orthologous TF(s) | Chy400_2954 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -46
Score: 6.2 Sequence: GTCAATGAACGACCAATCTC
Locus tag: Chy400_2954
|
||||
Chy400_2954 | -46 | 6.2 | GTCAATGAACGACCAATCTC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: bfrR | ||||
Ortholog function: Predicted transcriptional regulator for fructooligosaccharides utilization, LacI family | ||||
Chloroflexus sp. Y-400-fl | Chy400_2954 | -46 | 6.2 | GTCAATGAACGACCAATCTC |
Chloroflexus aggregans DSM 9485 | Cagg_3715 | -46 | 6.4 | GTCAATGGACGACCAATCTC |