Propagation of LACR_0766 regulog to Streptococcus dysgalactiae subsp. equisimilis GGS_124

Reference regulog properties
Source regulog:	LACR_0766 - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus dysgalactiae subsp. equisimilis GGS_124
Orthologous TF(s)	SDEG_1904
Regulated genes	2

Built upon 3 sites [see more]

Predicted regulatory interactions in *Streptococcus dysgalactiae subsp. equisimilis GGS_124*
	Locus tag	Position	Score	Sequence
Position: -121 Score: 6.3 Sequence: TCGGTTTAACGATAAACTAA Locus tag: SDEG_1903
	SDEG_1903	-121	6.3	TCGGTTTAACGATAAACTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: LACR_0761
Ortholog function: Predicted polysaccharide ABC transporter, permease protein 1
Lactococcus lactis subsp. cremoris SK11	LACR_0761	-35	6.3	AGAGTTTAACGTTAAACTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1903	-121	6.3	TCGGTTTAACGATAAACTAA

Position: -232 Score: 5.8 Sequence: TAGGTTTATCGTTAAACTAT Locus tag: SDEG_1904
	SDEG_1904	-232	5.8	TAGGTTTATCGTTAAACTAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: LACR_0766
Ortholog function: Predicted sugar utilization transcriptional regulator, LacI family
Lactococcus lactis subsp. cremoris SK11	LACR_0766	-35	6.3	AGAGTTTAACGTTAAACTAA
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1904	-232	5.8	TAGGTTTATCGTTAAACTAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --