Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CcpN regulog to Streptococcus dysgalactiae subsp. equisimilis GGS_124

Reference regulog properties
Source regulog: CcpN - Streptococcaceae
Regulator type: Transcription factor
Regulator family: CcpN
Regulation mode: repressor
Biological process: Gluconeogenesis
Effector:
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus dysgalactiae subsp. equisimilis GGS_124
Orthologous TF(s) SDEG_1842
Regulated genes 1
Built upon 7 sites [see more]
Predicted regulatory interactions in Streptococcus dysgalactiae subsp. equisimilis GGS_124
Locus tag Position Score Sequence
Position: -174
Score: 5.4
Sequence: ATATAATGTACCATATATAAT
Locus tag: SDEG_1842
SDEG_1842 -174 5.4 ATATAATGTACCATATATAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: yqfL
Ortholog function: Predicted phosphotransferase
Streptococcus agalactiae 2603V/R SAG1672 -171 5.7 ATATAATATAACATATAAAAT
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1842 -174 5.4 ATATAATGTACCATATATAAT
Streptococcus uberis 0140J SUB1521 -44 5.9 ATATAATATACTATATAATAA