Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of CelR regulog to Streptococcus dysgalactiae subsp. equisimilis GGS_124

Reference regulog properties
Source regulog: CelR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: CelB, cellobiose-specific PTS component EIIB; HPr, phosphocarrier protein
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus dysgalactiae subsp. equisimilis GGS_124
Orthologous TF(s) SDEG_1400
Regulated genes 1
Built upon 15 sites [see more]
Predicted regulatory interactions in Streptococcus dysgalactiae subsp. equisimilis GGS_124
Locus tag Position Score Sequence
Position: -83
Score: 5.5
Sequence: TTGCCGTAGTGCTAAGGAAA
Locus tag: SDEG_1401
SDEG_1401 -83 5.5 TTGCCGTAGTGCTAAGGAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celB
Ortholog function: Cellobiose-specific PTS, component EIIB
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1401 -83 5.5 TTGCCGTAGTGCTAAGGAAA
Streptococcus gallolyticus UCN34 GALLO_1213 -93 5.9 TTTCCTTATCAAAGAGGAAA
Streptococcus gordonii str. Challis substr. CH1 SGO_1580 -96 6.3 TTTCCGTTTCGATACGGAAA
Streptococcus mutans UA159 SMU.1600 -92 5.3 TTCCGTTTTCAATACGGAAA
Streptococcus pneumoniae TIGR4 SP_0305 -125 5.7 TTTCCATATCATTTAGGAAA
Streptococcus uberis 0140J SUB0529 -141 4.8 TTGCTTTTTTAATAGGGAAA
-100 6 TTTCCGCATCATTACGGAAA