Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of NiaR regulog to Streptococcus mutans NN2025

Reference regulog properties
Source regulog: NiaR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: NiaR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Niacin
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus mutans NN2025
Orthologous TF(s) SmuNN2025_1619
Regulated genes 1
Built upon 23 sites [see more]
Predicted regulatory interactions in Streptococcus mutans NN2025
Locus tag Position Score Sequence
Position: -74
Score: 5
Sequence: AATATATGTCTTGACACATGTA
Locus tag: SmuNN2025_1082
SmuNN2025_1082 -74 5 AATATATGTCTTGACACATGTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pnuC
Ortholog function: Ribosyl nicotinamide transporter, PnuC-like
Streptococcus mutans UA159 SMU.946 -74 5 aAtataTGTCTTgACACaTGTA
© 2009-2020 RegPrecise