Propagation of AgaR regulog to Streptococcus pneumoniae JJA
Source regulog: | AgaR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | N-acetylgalactosamine utilization |
Effector: | N-acetylgalactosamine |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus pneumoniae JJA |
Orthologous TF(s) | SPJ_0089 |
Regulated genes | 2 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -284
Score: 5.6 Sequence: TTTGTTGTTATATTAATTAT
Locus tag: SPJ_0089
|
||||
SPJ_0089 | -284 | 5.6 | TTTGTTGTTATATTAATTAT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: agaR | ||||
Ortholog function: N-acetylgalactosamine utilization transcriptional regulator AgaR, GntR family | ||||
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_0678 | -51 | 5.3 | TTTTTTGTTATAATAGCTAA |
Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_0740 | -43 | 4.7 | ATTTTTGCTATAATCGTATT |
Streptococcus gordonii str. Challis substr. CH1 | SGO_0042 | -107 | 5.6 | TTAATTAATATAATAACATT |
Streptococcus mitis B6 | smi_0078 | -282 | 5.5 | TTTGTTGATATATTAAATAT |
Streptococcus pneumoniae TIGR4 | SP_0058 | -312 | 5.6 | TTTGTTGTTATATTAATTAT |
Streptococcus sanguinis SK36 | SSA_0052 | -98 | 5.5 | AATATTAATATAATAAATTT |
Streptococcus suis 05ZYH33 | SSU05_0448 | -157 | 4.9 | TCTATTAATATACTAACACT |
Streptococcus uberis 0140J | SUB0041 | -53 | 5.1 | ATTTCTGTTATAATAGTTCT |
Position: -56
Score: 5.6 Sequence: ATAATTAATATAACAACAAA
Locus tag: SPJ_0090
|
||||
SPJ_0090 | -56 | 5.6 | ATAATTAATATAACAACAAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: bgaC | ||||
Ortholog function: Beta-galactosidase (EC 3.2.1.23) | ||||
Streptococcus gordonii str. Challis substr. CH1 | SGO_0043 | -67 | 5.6 | AATGTTATTATATTAATTAA |
Streptococcus mitis B6 | smi_0079 | -56 | 5.5 | ATATTTAATATATCAACAAA |
Streptococcus pneumoniae TIGR4 | SP_0060 | -56 | 5.6 | ATAATTAATATAACAACAAA |
Streptococcus sanguinis SK36 | SSA_0053 | -61 | 5.5 | AAATTTATTATATTAATATT |