Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of TreR regulog to Streptococcus pyogenes NZ131

Reference regulog properties
Source regulog: TreR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pyogenes NZ131
Orthologous TF(s) Spy49_1738
Regulated genes 2
Built upon 16 sites [see more]
Predicted regulatory interactions in Streptococcus pyogenes NZ131
Locus tag Position Score Sequence
Position: -128
Score: 5.9
Sequence: ACAACTTGCAGACAAATTTG
Locus tag: Spy49_1737c
Spy49_1737c -128 5.9 ACAACTTGCAGACAAATTTG
Supported by regulated orthologs from reference regulons
Ortholog gene name: treP
Ortholog function: Trehalose-specific PTS system, EIIABC component (EC 2.7.1.69)
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_2069 -128 6 ACAACTTGTAGACAAATTTG
Streptococcus gallolyticus UCN34 GALLO_2175 -99 5.6 ACAACTTGCAGACAAAATGG
Streptococcus gordonii str. Challis substr. CH1 SGO_1653 -106 5.4 ACATCTTGCATACACGTTTG
Streptococcus mutans UA159 SMU.2038 -94 5.6 ACAACTTGCCAACAAATTTG
Streptococcus pneumoniae TIGR4 SP_1884 -80 5.8 ACAAGTTGCAGACAAGTTTG
Streptococcus pyogenes M1 GAS SPy2097 -128 6 ACAACTTGTAGACAAATTTG
Streptococcus sanguinis SK36 SSA_1752 -47 5.5 ACAACTTGCATACATCTTTG
Streptococcus uberis 0140J SUB1763 -135 5.9 ACAACTTGCCTACAAATTTG
Position: -102
Score: 5.9
Sequence: CAAATTTGTCTGCAAGTTGT
Locus tag: Spy49_1738
Spy49_1738 -102 5.9 CAAATTTGTCTGCAAGTTGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: treR
Ortholog function: Trehalose utilization transcriptional regulator TreR, GntR family
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_2070 -102 6 CAAATTTGTCTACAAGTTGT
Streptococcus gallolyticus UCN34 GALLO_2176 -116 5.6 CCATTTTGTCTGCAAGTTGT
Streptococcus gordonii str. Challis substr. CH1 SGO_1654 -93 5.4 CAAACGTGTATGCAAGATGT
Streptococcus mutans UA159 SMU.2040 -99 5.6 CAAATTTGTTGGCAAGTTGT
Streptococcus pneumoniae TIGR4 SP_1885 -124 5.8 CAAACTTGTCTGCAACTTGT
Streptococcus pyogenes M1 GAS SPy2099 -102 6 CAAATTTGTCTACAAGTTGT
Streptococcus sanguinis SK36 SSA_1753 -91 5.5 CAAAGATGTATGCAAGTTGT
Streptococcus uberis 0140J SUB1764 -104 5.9 CAAATTTGTAGGCAAGTTGT